Stem-loop sequence pte-mir-35q-2

AccessionMI0038085 (change log)
DescriptionParasteatoda tepidariorum miR-35q-2 stem-loop
Stem-loop
   --a           u       u  ucaaaa 
5'    cgaaauaguuu aucuggu ac      u
      ||||||||||| ||||||| ||       
3'    guuuuaucaag uaggcca ug      u
   uug           -       c  uuaaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_9832: 27-87 [-]
intergenic
Clustered miRNAs
< 10kb from pte-mir-35q-2
pte-mir-35n-2Scf5bK3_9832: 784-842 [-]
pte-mir-35q-2Scf5bK3_9832: 27-87 [-]
Database links

Mature sequence pte-miR-35q-5p

Accession MIMAT0046210
Sequence

1 - 

acgaaauaguuuuaucugguuac

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-35q-3p

Accession MIMAT0046167
Sequence

40 - 

caccggaugaacuauuuugguu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).