Stem-loop sequence pte-mir-35k

AccessionMI0038062 (change log)
DescriptionParasteatoda tepidariorum miR-35k stem-loop
Stem-loop
   --uu     cu    a    a   uaca 
5'     gaauc  ucac cggu auu    u
       |||||  |||| |||| |||     
3'     uuuag  agug gcca uaa    c
   uucg     cu    g    c   uagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_786: 6359629-6359684 [-]
intergenic
Clustered miRNAs
< 10kb from pte-mir-35k
pte-mir-35kScf5bK3_786: 6359629-6359684 [-]
pte-mir-35j-2Scf5bK3_786: 6359442-6359498 [-]
pte-mir-35e-1Scf5bK3_786: 6359147-6359203 [-]
pte-mir-35r-3Scf5bK3_786: 6356599-6356660 [-]
Database links

Mature sequence pte-miR-35k-5p

Accession MIMAT0046172
Sequence

1 - 

uugaauccuucacacgguaauu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-35k-3p

Accession MIMAT0046173
Sequence

35 - 

ucaccgggugaucgauuugcuu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).