Stem-loop sequence pte-mir-35n-1

AccessionMI0038060 (change log)
DescriptionParasteatoda tepidariorum miR-35n-1 stem-loop
Stem-loop
   --u       -      a    a    cuu 
5'    cgaaucu uucucu cggu auuu   a
      ||||||| |||||| |||| ||||   u
3'    guuuaga aagagg gcca uaaa   u
   uuc       u      -    c    aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_3068: 16552-16610 [+]
intergenic
Clustered miRNAs
< 10kb from pte-mir-35n-1
pte-mir-35pScf5bK3_3068: 10790-10846 [+]
pte-mir-35j-1Scf5bK3_3068: 12165-12221 [+]
pte-mir-35e-2Scf5bK3_3068: 12460-12516 [+]
pte-mir-35n-1Scf5bK3_3068: 16552-16610 [+]
pte-mir-35q-1Scf5bK3_3068: 17321-17380 [+]
pte-mir-35q-1Scf5bK3_3068: 17457-17516 [+]
pte-mir-35r-2Scf5bK3_3068: 20244-20305 [+]
Database links

Mature sequence pte-miR-35n-5p

Accession MIMAT0046170
Sequence

1 - 

ucgaaucuuucucuacgguaauu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-35n-3p

Accession MIMAT0046171
Sequence

37 - 

ucaccgggagaauagauuugcuu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).