Stem-loop sequence pte-mir-317

AccessionMI0038054 (change log)
DescriptionParasteatoda tepidariorum miR-317 stem-loop
Stem-loop
   --c    -   u  --   c       -agu  c 
5'    gaga gcc cc  cug guucaca    gc g
      |||| ||| ||  ||| |||||||    || u
3'    cucu ugg gg  gac caagugu    cg u
   uga    a   u  uc   a       cuuu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_269: 1823433-1823497 [+]
intergenic
Clustered miRNAs
< 10kb from pte-mir-317
pte-mir-317Scf5bK3_269: 1823433-1823497 [+]
pte-mir-277bScf5bK3_269: 1826846-1826899 [+]
Database links

Mature sequence pte-miR-317-5p

Accession MIMAT0046158
Sequence

1 - 

cgagagccucccugcguucaca

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-317-3p

Accession MIMAT0046159
Sequence

41 - 

ugaacacagcuggugguaucucagu

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).