Stem-loop sequence pte-mir-278a

AccessionMI0038034 (change log)
DescriptionParasteatoda tepidariorum miR-278a stem-loop
Stem-loop
   --c       a       u   a  guaua 
5'    cggauga aauucca ccg cc     g
      ||||||| ||||||| ||| ||      
3'    gccugcu uuagggu ggc gg     u
   ucu       g       -   c  acagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_193: 2756450-2756508 [+]
intergenic
Database links

Mature sequence pte-miR-278a-5p

Accession MIMAT0046120
Sequence

1 - 

ccggaugaaaauuccauccgacc

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-278a-3p

Accession MIMAT0046121
Sequence

38 - 

ccggugggauugucguccgucu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).