Stem-loop sequence pte-mir-277b

AccessionMI0038033 (change log)
DescriptionParasteatoda tepidariorum miR-277b stem-loop
Stem-loop
   --c    c     -      a    uag 
5'    guuc agagg ugcauu uaca   a
      |||| ||||| |||||| ||||    
3'    caag ucucc acguaa augu   c
   uac    a     c      -    uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_269: 1826846-1826899 [+]
intergenic
Clustered miRNAs
< 10kb from pte-mir-277b
pte-mir-317Scf5bK3_269: 1823433-1823497 [+]
pte-mir-277bScf5bK3_269: 1826846-1826899 [+]
Database links

Mature sequence pte-miR-277b-5p

Accession MIMAT0046118
Sequence

1 - 

cguuccagaggugcauuauac

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-277b-3p

Accession MIMAT0046119
Sequence

33 - 

uaaaugcacccucuagaaccau

 - 54

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).