Stem-loop sequence pte-mir-277a

AccessionMI0038032 (change log)
DescriptionParasteatoda tepidariorum miR-277a stem-loop
Stem-loop
   --           -          uuagug  u 
5'   cguuccagaag ugcguuuaca      uc u
     ||||||||||| ||||||||||      ||  
3'   guaaggucuuu acguaaaugu      ag a
   au           u          --cuaa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_265: 8587537-8587599 [+]
intergenic
Database links

Mature sequence pte-miR-277a-5p

Accession MIMAT0046116
Sequence

1 - 

cguuccagaagugcguuuaca

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-277a-3p

Accession MIMAT0046117
Sequence

42 - 

uaaaugcauuuucuggaaugua

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).