Stem-loop sequence pte-mir-263b

AccessionMI0038028 (change log)
DescriptionParasteatoda tepidariorum miR-263b stem-loop
Stem-loop
   --a       ug  a   uu      uaau 
5'    auggcac  ga gaa  cacgga    g
      |||||||  || |||  ||||||    u
3'    uaucgug  cu cuu  gugccu    u
   gaa       gu  -   ug      cagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_537.1: 22563773-22563832 [+]
intergenic
Database links

Mature sequence pte-miR-263b-5p

Accession MIMAT0046109
Sequence

1 - 

aauggcacuggaagaauucacgg

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-263b-3p

Accession MIMAT0046110
Sequence

39 - 

gugguuucucuggugcuauaag

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).