Stem-loop sequence pte-bantam

AccessionMI0038009 (change log)
DescriptionParasteatoda tepidariorum bantam stem-loop
Stem-loop
   --cu       c        auc    ggaau 
5'     gguuuuc caaugauc   caga     a
       ||||||| ||||||||   ||||     u
3'     ucgaaag guuacuag   gucu     a
   uuag       u        --a    aaagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_3958: 148742-148804 [+]
intergenic
Database links

Mature sequence pte-bantam-5p

Accession MIMAT0046075
Sequence

1 - 

cugguuuucccaaugaucaucca

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-bantam-3p

Accession MIMAT0046076
Sequence

41 - 

ugagaucauugugaaagcugauu

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).