Stem-loop sequence tca-mir-11626a

AccessionMI0037392 (change log)
DescriptionTribolium castaneum miR-11626a stem-loop
Stem-loop
   gaaac ug --          ucau   -uuu  u        -----           g     auga      u        uuga 
5'      c  c  cagggguaag    gau    cg caagauuu     ugguuuuguuu uuggc    uugauu agcucaug    a
        |  |  ||||||||||    |||    || ||||||||     ||||||||||| |||||    |||||| ||||||||    u
3'      g  g  guuucuauuc    uua    gu guuuuaag     accgaggcaaa agccg    aacuag uugaguac    u
   ----a gu aa          -uuu   uuuu  -        ccucc           g     gaug      -        uugg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG6: 273458-273621 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-11626a
tca-mir-11626aChLG6: 273458-273621 [-]
tca-mir-11625aChLG6: 273252-273366 [-]
tca-mir-3851jChLG6: 273130-273224 [-]
tca-mir-3851iChLG6: 273027-273118 [-]
tca-mir-3858bChLG6: 272928-273018 [-]
tca-mir-11642ChLG6: 272831-272890 [-]
Database links

Mature sequence tca-miR-11626a-5p

Accession MIMAT0045540
Sequence

54 - 

uggcaugauugauuuagcucaug

 - 76

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tca-miR-11626a-3p

Accession MIMAT0045541
Sequence

90 - 

ugaguugaucaaguaggccgag

 - 111

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).