Stem-loop sequence bdo-mir-11597

AccessionMI0037329 (change log)
DescriptionBactrocera dorsalis miR-11597 stem-loop
Literature search

1 open access papers mention bdo-mir-11597
(1 sentences)

Stem-loop
   ----     g     u c       cag      -gcuag     a 
5'     ucgug cuguu c caccaua   cggggu      guggc c
       ||||| ||||| | |||||||   ||||||      |||||  
3'     agcac gacaa g gugguau   gcccca      caccg a
   cugc     -     - c       aua      aacaaa     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold01468: 5158-5244 [+]
intergenic
Database links

Mature sequence bdo-miR-11597

Accession MIMAT0045450
Sequence

63 - 

uauauggugcgaacagcacgacguc

 - 87

Get sequence
Evidence experimental; Torrent [1]

References

1