Stem-loop sequence bdo-mir-11596

AccessionMI0037328 (change log)
DescriptionBactrocera dorsalis miR-11596 stem-loop
Literature search

1 open access papers mention bdo-mir-11596
(1 sentences)

Stem-loop
   --   u  a      gc     uagu  cu      a 
5'   ucc gg gguuca  cggag    uc  ccauga u
     ||| || ||||||  |||||    ||  |||||| u
3'   agg cc ccaggu  gccuc    ag  gguacu c
   cc   u  c      au     ---u  ag      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold01114: 3904-3975 [+]
intergenic
Database links

Mature sequence bdo-miR-11596

Accession MIMAT0045449
Sequence

1 - 

uccuggagguucagccggaguagu

 - 24

Get sequence
Evidence experimental; Torrent [1]

References

1