Stem-loop sequence bdo-mir-11594

AccessionMI0037322 (change log)
DescriptionBactrocera dorsalis miR-11594 stem-loop
Literature search

1 open access papers mention bdo-mir-11594
(1 sentences)

Stem-loop
   --a               g  c    uuuca 
5'    ccacuacucaaaugg gu uuug     a
      ||||||||||||||| || ||||      
3'    ggugaugaguuuacc ca aaac     c
   gcc               g  c    uuccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00003: 608597-608658 [-]
intergenic
Database links

Mature sequence bdo-miR-11594

Accession MIMAT0045443
Sequence

41 - 

cacgccauuugaguaguggccg

 - 62

Get sequence
Evidence experimental; Torrent [1]

References

1