Stem-loop sequence bdo-mir-11593

AccessionMI0037320 (change log)
DescriptionBactrocera dorsalis miR-11593 stem-loop
Literature search

1 open access papers mention bdo-mir-11593
(1 sentences)

Stem-loop
   --  c          g  a     ugaaa 
5'   uc augaaauucu ua uucug     g
     || |||||||||| || |||||      
3'   ag uacuuuaaga au aggac     u
   aa  u          g  a     uuaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00003: 476312-476369 [+]
intergenic
Database links

Mature sequence bdo-miR-11593

Accession MIMAT0045441
Sequence

1 - 

uccaugaaauucuguaauucug

 - 22

Get sequence
Evidence experimental; Torrent [1]

References

1