Stem-loop sequence bdo-mir-306

AccessionMI0037318 (change log)
DescriptionBactrocera dorsalis miR-306 stem-loop
Literature search

1 open access papers mention bdo-mir-306
(1 sentences)

Stem-loop
   --cc      uu           -a  ----a     
5'     agguac  agugacucuca  gu     ggca 
       ||||||  |||||||||||  ||     ||| u
3'     uccgug  ucauugggagu  ca     ccgu 
   cgaa      uu           cg  auuua     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00027: 1321794-1321859 [-]
intergenic
Clustered miRNAs
< 10kb from bdo-mir-306
bdo-mir-9cscaffold00027: 1324097-1324160 [-]
bdo-mir-306scaffold00027: 1321794-1321859 [-]
bdo-mir-79scaffold00027: 1321252-1321313 [-]
bdo-mir-9bscaffold00027: 1320120-1320184 [-]
Database links

Mature sequence bdo-miR-306

Accession MIMAT0045439
Sequence

1 - 

ccagguacuuagugacucuca

 - 21

Get sequence
Evidence experimental; Torrent [1]

References

1