Stem-loop sequence bdo-mir-2b-1

AccessionMI0037317 (change log)
DescriptionBactrocera dorsalis miR-2b-1 stem-loop
Literature search

1 open access papers mention bdo-mir-2b-1
(4 sentences)

Stem-loop
   --          -      c  a   uugacauuuucugcuu 
5'   uucuucaaag uggcug ga aug                a
     |||||||||| |||||| || |||                a
3'   gaggaguuuc accgac cu uac                a
   gc          g      a  a   uuaaaguuuuuauaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00002: 2205154-2205237 [-]
intergenic
Clustered miRNAs
< 10kb from bdo-mir-2b-1
bdo-mir-2b-1scaffold00002: 2205154-2205237 [-]
bdo-mir-2a-1scaffold00002: 2204625-2204688 [-]
bdo-mir-2a-2scaffold00002: 2204162-2204222 [-]
Database links

Mature sequence bdo-miR-2b

Accession MIMAT0045416
Sequence

61 - 

uaucacagccagcuuugaggagcg

 - 84

Get sequence
Evidence experimental; Torrent [1]

References

1