Stem-loop sequence bdo-mir-318

AccessionMI0037315 (change log)
DescriptionBactrocera dorsalis miR-318 stem-loop
Literature search

1 open access papers mention bdo-mir-318
(2 sentences)

Stem-loop
   --     u  c         uu  ---uu   au  u 
5'   agaua ac aaguucagu  ug     caa  ga u
     ||||| || |||||||||  ||     |||  ||  
3'   ucuau ug uucggguca  ac     guu  cu g
   ac     u  u         cu  uuucc   gu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00147: 463660-463730 [-]
intergenic
Clustered miRNAs
< 10kb from bdo-mir-318
bdo-mir-994scaffold00147: 463833-463903 [-]
bdo-mir-318scaffold00147: 463660-463730 [-]
Database links

Mature sequence bdo-miR-318

Accession MIMAT0045437
Sequence

50 - 

ucacugggcuuuguuuaucuca

 - 71

Get sequence
Evidence experimental; Torrent [1]

References

1