Stem-loop sequence bdo-mir-995

AccessionMI0037314 (change log)
DescriptionBactrocera dorsalis miR-995 stem-loop
Literature search

1 open access papers mention bdo-mir-995
(1 sentences)

Stem-loop
   --   cgu         a       cuucuauc 
5'   gcc   aucaugugg ugcugcg        a
     |||   ||||||||| |||||||         
3'   cgg   uaguacacc acgaugc        a
   uu   -cu         -       acauuauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00041: 1461882-1461945 [+]
intergenic
Database links

Mature sequence bdo-miR-995

Accession MIMAT0045436
Sequence

44 - 

uagcaccacaugauucggcuu

 - 64

Get sequence
Evidence experimental; Torrent [1]

References

1