Stem-loop sequence bdo-mir-252

AccessionMI0037313 (change log)
DescriptionBactrocera dorsalis miR-252 stem-loop
Literature search

1 open access papers mention bdo-mir-252
(1 sentences)

Stem-loop
   --c        a u  c     agauaguucaaac 
5'    uaaguacu g gc gcagg             g
      |||||||| | || |||||              
3'    auucguga c cg cgucc             a
   acu        c c  u     ccagaugaugcac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00214: 97423-97492 [+]
intergenic
Database links

Mature sequence bdo-miR-252

Accession MIMAT0045435
Sequence

1 - 

cuaaguacuagugccgcaggag

 - 22

Get sequence
Evidence experimental; Torrent [1]

References

1