Stem-loop sequence bdo-mir-11

AccessionMI0037312 (change log)
DescriptionBactrocera dorsalis miR-11 stem-loop
Literature search

1 open access papers mention bdo-mir-11
(2 sentences)

Stem-loop
   --         u        uu    uuucacaau 
5'   cgggagcuc ggcuguga  ugcg         c
     ||||||||| ||||||||  ||||         a
3'   guucuugag cugacacu  acgc         a
   uc         u        --    uuuacuuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00005: 2323679-2323747 [+]
intergenic
Clustered miRNAs
< 10kb from bdo-mir-11
bdo-mir-11scaffold00005: 2323679-2323747 [+]
bdo-mir-998scaffold00005: 2326077-2326162 [+]
Database links

Mature sequence bdo-miR-11

Accession MIMAT0045434
Sequence

48 - 

caucacagucugaguucuugcu

 - 69

Get sequence
Evidence experimental; Torrent [1]

References

1