Stem-loop sequence bdo-mir-14

AccessionMI0037310 (change log)
DescriptionBactrocera dorsalis miR-14 stem-loop
Literature search

1 open access papers mention bdo-mir-14
(1 sentences)

Stem-loop
   --     c    u       u    ucauuu   a 
5'   gggag gaga agggacu gcug      gaa a
     ||||| |||| ||||||| ||||      |||  
3'   uccuc cucu uuucuga ugac      uuu a
   ua     u    u       c    caacau   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00236: 279336-279405 [-]
intergenic
Database links

Mature sequence bdo-miR-14

Accession MIMAT0045432
Sequence

49 - 

ucagucuuuuucucucuccuau

 - 70

Get sequence
Evidence experimental; Torrent [1]

References

1