Stem-loop sequence bdo-mir-282

AccessionMI0037308 (change log)
DescriptionBactrocera dorsalis miR-282 stem-loop
Literature search

1 open access papers mention bdo-mir-282
(2 sentences)

Stem-loop
   --        ac      u      -   gagu 
5'   uagccucu  uaggcu ugucug ugu    u
     ||||||||  |||||| |||||| |||    u
3'   auuggaga  auccga acagac aua    a
   gg        aa      u      u   agaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00001: 5403970-5404035 [-]
intergenic
Database links

Mature sequence bdo-miR-282

Accession MIMAT0045430
Sequence

45 - 

acauagccuaaaagagguuagg

 - 66

Get sequence
Evidence experimental; Torrent [1]

References

1