Stem-loop sequence bdo-mir-5b-2

AccessionMI0037305 (change log)
DescriptionBactrocera dorsalis miR-5b-2 stem-loop
Literature search

2 open access papers mention bdo-mir-5b-2
(6 sentences)

Stem-loop
   -a      c               ----   a 
5'   aaggaa gaucguugugguaua    ugu u
     |||||| |||||||||||||||    ||| u
3'   uuccuu uuagugacacuauau    acg u
   ug      -               cuga   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00054: 204041-204101 [-]
intergenic
Clustered miRNAs
< 10kb from bdo-mir-5b-2
bdo-mir-5b-1scaffold00054: 206689-206749 [-]
bdo-mir-309bscaffold00054: 205267-205336 [-]
bdo-mir-286scaffold00054: 204944-205010 [-]
bdo-mir-5b-2scaffold00054: 204041-204101 [-]
bdo-mir-6scaffold00054: 203903-203964 [-]
bdo-mir-309ascaffold00054: 203737-203796 [-]
bdo-mir-4scaffold00054: 203559-203615 [-]
bdo-mir-5ascaffold00054: 203235-203297 [-]
Database links

Mature sequence bdo-miR-5b

Accession MIMAT0045420
Sequence

41 - 

uaucacagugauuuuccuugu

 - 61

Get sequence
Evidence experimental; Torrent [1]

References

1