Stem-loop sequence bdo-mir-994

AccessionMI0037304 (change log)
DescriptionBactrocera dorsalis miR-994 stem-loop
Literature search

1 open access papers mention bdo-mir-994
(5 sentences)

Stem-loop
   ----u              c     uuuauuca  u 
5'      aaggaaauaguagc gugau        ac c
        |||||||||||||| |||||        || g
3'      uuucuuugucguug cacua        ug a
   uagau              a     uacguuug  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00147: 463833-463903 [-]
intergenic
Clustered miRNAs
< 10kb from bdo-mir-994
bdo-mir-994scaffold00147: 463833-463903 [-]
bdo-mir-318scaffold00147: 463660-463730 [-]
Database links

Mature sequence bdo-miR-994

Accession MIMAT0045427
Sequence

1 - 

uaaggaaauaguagccgugau

 - 21

Get sequence
Evidence experimental; Torrent [1]

References

1