Stem-loop sequence bdo-mir-87

AccessionMI0037302 (change log)
DescriptionBactrocera dorsalis miR-87 stem-loop
Literature search

1 open access papers mention bdo-mir-87
(2 sentences)

Stem-loop
   ---        -u  c     g     uaucuuu 
5'    cgcgccug  au uugcu aaccg       g
      ||||||||  || ||||| |||||        
3'    guguggac  ua aacga uuggc       c
   agu        uu  a     g     cuucuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00447: 75699-75764 [-]
intergenic
Database links

Mature sequence bdo-miR-87

Accession MIMAT0045425
Sequence

43 - 

uugagcaaaauuucagguguguga

 - 66

Get sequence
Evidence experimental; Torrent [1]

References

1