Stem-loop sequence bdo-mir-927

AccessionMI0037301 (change log)
DescriptionBactrocera dorsalis miR-927 stem-loop
Literature search

1 open access papers mention bdo-mir-927
(1 sentences)

Stem-loop
   --          cu       a   uag  a 
5'   uuuagaauuc  acgcuuu ccg   aa u
     ||||||||||  ||||||| |||   ||  
3'   aagucuuagg  ugcgaaa ggc   uu u
   ca          uu       c   uaa  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00941: 10434-10495 [-]
intergenic
Database links

Mature sequence bdo-miR-927

Accession MIMAT0045424
Sequence

1 - 

uuuagaauuccuacgcuuuaccg

 - 23

Get sequence
Evidence experimental; Torrent [1]

References

1