Stem-loop sequence bdo-mir-12

AccessionMI0037300 (change log)
DescriptionBactrocera dorsalis miR-12 stem-loop
Literature search

1 open access papers mention bdo-mir-12
(3 sentences)

Stem-loop
   --ug     u    c           ---------u  u 
5'     aguau acau agguacuggug          gc a
       ||||| |||| |||||||||||          ||  
3'     ucaua ugua uucaugaccau          cg u
   ccug     c    -           cuaaauuguu  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00073: 1266978-1267045 [+]
intergenic
Clustered miRNAs
< 10kb from bdo-mir-12
bdo-mir-283scaffold00073: 1264481-1264547 [+]
bdo-mir-304scaffold00073: 1266554-1266618 [+]
bdo-mir-12scaffold00073: 1266978-1267045 [+]
Database links

Mature sequence bdo-miR-12

Accession MIMAT0045423
Sequence

1 - 

ugaguauuacaucagguacugg

 - 22

Get sequence
Evidence experimental; Torrent [1]

References

1