Stem-loop sequence bdo-mir-5b-1

AccessionMI0037297 (change log)
DescriptionBactrocera dorsalis miR-5b-1 stem-loop
Literature search

2 open access papers mention bdo-mir-5b-1
(6 sentences)

Stem-loop
   -a      c               u u   u 
5'   aaggaa gaucguugugguaua g auu u
     |||||| ||||||||||||||| | ||| g
3'   uuccuu uuagugacacuauau c uga a
   ug      -               - -   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00054: 206689-206749 [-]
intergenic
Clustered miRNAs
< 10kb from bdo-mir-5b-1
bdo-mir-5b-1scaffold00054: 206689-206749 [-]
bdo-mir-309bscaffold00054: 205267-205336 [-]
bdo-mir-286scaffold00054: 204944-205010 [-]
bdo-mir-5b-2scaffold00054: 204041-204101 [-]
bdo-mir-6scaffold00054: 203903-203964 [-]
bdo-mir-309ascaffold00054: 203737-203796 [-]
bdo-mir-4scaffold00054: 203559-203615 [-]
bdo-mir-5ascaffold00054: 203235-203297 [-]
Database links

Mature sequence bdo-miR-5b

Accession MIMAT0045420
Sequence

41 - 

uaucacagugauuuuccuugu

 - 61

Get sequence
Evidence experimental; Torrent [1]

References

1