Stem-loop sequence bdo-mir-2a-2

AccessionMI0037294 (change log)
DescriptionBactrocera dorsalis miR-2a-2 stem-loop
Literature search

1 open access papers mention bdo-mir-2a-2
(4 sentences)

Stem-loop
   --c         --             - auu 
5'    cucaucaag  ugguugugauaug g   c
      |||||||||  ||||||||||||| |    
3'    gaguaguuu  accgacacuauac c   u
   auc         cg             g aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00002: 2204162-2204222 [-]
intergenic
Clustered miRNAs
< 10kb from bdo-mir-2a-2
bdo-mir-2b-1scaffold00002: 2205154-2205237 [-]
bdo-mir-2a-1scaffold00002: 2204625-2204688 [-]
bdo-mir-2a-2scaffold00002: 2204162-2204222 [-]
Database links

Mature sequence bdo-miR-2a-2

Accession MIMAT0045417
Sequence

39 - 

ucacagccagcuuugaugagcua

 - 61

Get sequence
Evidence experimental; Torrent [1]

References

1