Stem-loop sequence bdo-mir-2b-2

AccessionMI0037293 (change log)
DescriptionBactrocera dorsalis miR-2b-2 stem-loop
Literature search

1 open access papers mention bdo-mir-2b-2
(4 sentences)

Stem-loop
   --           -        a   -   ca 
5'   uucuucaaagc gguuguga aug uuu  u
     ||||||||||| |||||||| ||| |||   
3'   gaggaguuucg ccgacacu uac aaa  u
   gc           a        a   u   au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00022: 1637400-1637461 [-]
intergenic
Database links

Mature sequence bdo-miR-2b

Accession MIMAT0045416
Sequence

39 - 

uaucacagccagcuuugaggagcg

 - 62

Get sequence
Evidence experimental; Torrent [1]

References

1