Stem-loop sequence bdo-mir-1

AccessionMI0037291 (change log)
DescriptionBactrocera dorsalis miR-1 stem-loop
Literature search

1 open access papers mention bdo-mir-1
(1 sentences)

Stem-loop
   --    u    c        g   guac   a 
5'   ccau cuuc uugcauuc aua    uga a
     |||| |||| |||||||| |||    ||| a
3'   ggua gaag aauguaag uau    acu u
   ga    u    a        g   ----   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold01330: 2447-2507 [-]
intergenic
Database links

Mature sequence bdo-miR-1

Accession MIMAT0045414
Sequence

40 - 

uggaauguaaagaaguauggag

 - 61

Get sequence
Evidence experimental; Torrent [1]

References

1