Stem-loop sequence bdo-mir-10

AccessionMI0037290 (change log)
DescriptionBactrocera dorsalis miR-10 stem-loop
Literature search

1 open access papers mention bdo-mir-10
(3 sentences)

Stem-loop
   --   -  g    u           u g  g 
5'   acc cu uaga ccgaauuuguu u au u
     ||| || |||| ||||||||||| | ||  
3'   ugg ga aucu ggcuuaaacag g ug u
   uu   a  g    u           u g  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00063: 1439499-1439559 [+]
intergenic
Database links

Mature sequence bdo-miR-10

Accession MIMAT0045413
Sequence

1 - 

acccuguagauccgaauuuguu

 - 22

Get sequence
Evidence experimental; Torrent [1]

References

1