Stem-loop sequence bdo-mir-1000

AccessionMI0037289 (change log)
DescriptionBactrocera dorsalis miR-1000 stem-loop
Literature search

1 open access papers mention bdo-mir-1000
(1 sentences)

Stem-loop
   --a  u       -  a        --     cuuc 
5'    ua uguccug uc cagcagua  cuguu    u
      || ||||||| || ||||||||  |||||    c
3'    au acggggc gg gucgucau  gauag    g
   aca  u       c  -        cc     uaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00020: 1908105-1908173 [+]
intergenic
Database links

Mature sequence bdo-miR-1000

Accession MIMAT0045412
Sequence

1 - 

auauuguccugucacagcagu

 - 21

Get sequence
Evidence experimental; Torrent [1]

References

1