Stem-loop sequence bdo-mir-125

AccessionMI0037288 (change log)
DescriptionBactrocera dorsalis miR-125 stem-loop
Literature search

2 open access papers mention bdo-mir-125
(2 sentences)

Stem-loop
   -uc  u    c cu         cuuuu   a 
5'    cc gaga c  aacuuguga     aac u
      || |||| |  |||||||||     |||  
3'    gg cucu g  uugaacacu     uug c
   uau  c    a uu         -----   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00010: 2862662-2862721 [+]
intergenic
Clustered miRNAs
< 10kb from bdo-mir-125
bdo-mir-100scaffold00010: 2862114-2862172 [+]
bdo-let-7scaffold00010: 2862318-2862375 [+]
bdo-mir-125scaffold00010: 2862662-2862721 [+]
Database links

Mature sequence bdo-miR-125

Accession MIMAT0045411
Sequence

1 - 

ucccugagacccuaacuuguga

 - 22

Get sequence
Evidence experimental; Torrent [1]

References

1