Stem-loop sequence bdo-mir-13a

AccessionMI0037287 (change log)
DescriptionBactrocera dorsalis miR-13a stem-loop
Literature search

1 open access papers mention bdo-mir-13a
(3 sentences)

Stem-loop
   ---g        c        au    --    a 
5'     cguuaaaa gguuguga  uaug  uugc a
       |||||||| ||||||||  ||||  ||||  
3'     gcaguuuu ccgacacu  auac  aaug u
   uuga        a        --    cg    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00073: 242058-242120 [+]
intergenic
Database links

Mature sequence bdo-miR-13a

Accession MIMAT0045410
Sequence

41 - 

uaucacagccauuuugacgaguu

 - 63

Get sequence
Evidence experimental; Torrent [1]

References

1