Stem-loop sequence bdo-mir-13b

AccessionMI0037286 (change log)
DescriptionBactrocera dorsalis miR-13b stem-loop
Literature search

1 open access papers mention bdo-mir-13b
(3 sentences)

Stem-loop
   ---           u     uu    ---uc  c 
5'    ucguuaaaaug uugug  uaug     gc a
      ||||||||||| |||||  ||||     || u
3'    agcaguuuuac gacac  auac     cg u
   uug           c     -u    ucaua  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00020: 1021893-1021956 [+]
intergenic
Clustered miRNAs
< 10kb from bdo-mir-13b
bdo-mir-2cscaffold00020: 1019361-1019425 [+]
bdo-mir-13bscaffold00020: 1021893-1021956 [+]
Database links

Mature sequence bdo-miR-13b

Accession MIMAT0045409
Sequence

42 - 

uaucacagccauuuugacgaguu

 - 64

Get sequence
Evidence experimental; Torrent [1]

References

1