Stem-loop sequence bdo-mir-137

AccessionMI0037285 (change log)
DescriptionBactrocera dorsalis miR-137 stem-loop
Literature search

1 open access papers mention bdo-mir-137
(1 sentences)

Stem-loop
   --   c       ug   uac     c  ug 
5'   acg guauucu  ggu   uaaca gc  u
     ||| |||||||  |||   ||||| ||  u
3'   ugc cauaaga  ucg   auugu ug  u
   ga   a       gu   -uu     -  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00025: 1174638-1174698 [-]
intergenic
Database links

Mature sequence bdo-miR-137

Accession MIMAT0045408
Sequence

40 - 

uauugcuugagaauacacguag

 - 61

Get sequence
Evidence experimental; Torrent [1]

References

1