Stem-loop sequence bdo-mir-981

AccessionMI0037276 (change log)
DescriptionBactrocera dorsalis miR-981 stem-loop
Literature search

1 open access papers mention bdo-mir-981
(1 sentences)

Stem-loop
   --          aa          -   aaac 
5'   cggguuucgu  gcagcgggcu guu    u
     ||||||||||  |||||||||| |||     
3'   guccaaagca  uguugcuuga caa    g
   ac          gc          g   aauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00278: 154316-154378 [+]
intergenic
Database links

Mature sequence bdo-miR-981

Accession MIMAT0045399
Sequence

42 - 

uucguugucgacgaaaccugca

 - 63

Get sequence
Evidence experimental; Torrent [1]

References

1