Stem-loop sequence bdo-mir-276a

AccessionMI0037270 (change log)
DescriptionBactrocera dorsalis miR-276a stem-loop
Literature search

2 open access papers mention bdo-mir-276a
(4 sentences)

Stem-loop
   --    a     ag          uugua 
5'   agcg gguau  aguuccuacg     u
     |||| |||||  ||||||||||     u
3'   ucgu ccaua  ucaaggaugu     u
   uc    g     cu          uaaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00015: 288562-288620 [+]
intergenic
Database links

Mature sequence bdo-miR-276a

Accession MIMAT0045393
Sequence

38 - 

uaggaacuucauaccgugcucu

 - 59

Get sequence
Evidence experimental; Torrent [1]

References

1