Stem-loop sequence bdo-let-7

AccessionMI0037269 (change log)
DescriptionBactrocera dorsalis let-7 stem-loop
Literature search

2 open access papers mention bdo-let-7
(7 sentences)

Stem-loop
   --u   g     g           -  au 
5'    gag uagua guuguauagua gu  u
      ||| ||||| ||||||||||| ||  a
3'    uuc aucgu caacauaucgu cg  a
   ucu   g     g           a  gc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00010: 2862318-2862375 [+]
intergenic
Clustered miRNAs
< 10kb from bdo-let-7
bdo-mir-100scaffold00010: 2862114-2862172 [+]
bdo-let-7scaffold00010: 2862318-2862375 [+]
bdo-mir-125scaffold00010: 2862662-2862721 [+]
Database links

Mature sequence bdo-let-7

Accession MIMAT0045392
Sequence

1 - 

ugagguaguagguuguauagu

 - 21

Get sequence
Evidence experimental; Torrent [1]

References

1