Stem-loop sequence bdo-mir-100

AccessionMI0037263 (change log)
DescriptionBactrocera dorsalis miR-100 stem-loop
Literature search

1 open access papers mention bdo-mir-100
(1 sentences)

Stem-loop
   --aa       au   aa     ---  ugu 
5'     cccguaa  ccg  cuugu   gc   u
       |||||||  |||  |||||   ||    
3'     ggguauu  ggc  gaacg   ug   g
   cuga       ac   ca     uug  uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00010: 2862114-2862172 [+]
intergenic
Clustered miRNAs
< 10kb from bdo-mir-100
bdo-mir-100scaffold00010: 2862114-2862172 [+]
bdo-let-7scaffold00010: 2862318-2862375 [+]
bdo-mir-125scaffold00010: 2862662-2862721 [+]
Database links

Mature sequence bdo-miR-100

Accession MIMAT0045386
Sequence

1 - 

aacccguaaauccgaacuugug

 - 22

Get sequence
Evidence experimental; Torrent [1]

References

1