Stem-loop sequence bdo-mir-92b

AccessionMI0037262 (change log)
DescriptionBactrocera dorsalis miR-92b stem-loop
Literature search

1 open access papers mention bdo-mir-92b
(1 sentences)

Stem-loop
   --      u c       uu      uuuuugu 
5'   aggucg g cuggugc  aauuug       u
     |||||| | |||||||  ||||||       a
3'   uccggc c gaucacg  uuaaac       u
   cg      c u       --      ucugugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00012: 2827330-2827394 [-]
intergenic
Database links

Mature sequence bdo-miR-92b

Accession MIMAT0045385
Sequence

44 - 

aauugcacuagucccggccugc

 - 65

Get sequence
Evidence experimental; Torrent [1]

References

1