Stem-loop sequence bdo-mir-998

AccessionMI0037255 (change log)
DescriptionBactrocera dorsalis miR-998 stem-loop
Stem-loop
   --a      u        u     ---------     -------    au 
5'    cugaau cucguggu cugca         uugca       uacc  g
      |||||| |||||||| |||||         |||||       ||||  a
3'    gacuua gaguacca gaugu         aaugu       augg  c
   cuc      -        c     uuuaaaguu     uaugcaa    ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00005: 2326077-2326162 [+]
intergenic
Clustered miRNAs
< 10kb from bdo-mir-998
bdo-mir-11scaffold00005: 2323679-2323747 [+]
bdo-mir-998scaffold00005: 2326077-2326162 [+]
Database links

Mature sequence bdo-miR-998

Accession MIMAT0045378
Sequence

66 - 

uagcaccaugagauucagcuc

 - 86

Get sequence
Evidence experimental; Torrent [1]

References

1