Stem-loop sequence bdo-mir-996

AccessionMI0037252 (change log)
DescriptionBactrocera dorsalis miR-996 stem-loop
Literature search

1 open access papers mention bdo-mir-996
(1 sentences)

Stem-loop
   -     a      -      g     uuuauuc 
5'  ggcga caugga ucuagu cacgg       a
    ||||| |||||| |||||| |||||       u
3'  cugcu guacuu agauca gugcu       a
   u     c      u      -     ugaacua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00218: 41377-41442 [-]
intergenic
Database links

Mature sequence bdo-miR-996

Accession MIMAT0045375
Sequence

1 - 

ggcgaacauggaucuagugcacg

 - 23

Get sequence
Evidence experimental; Torrent [1]

References

1