Stem-loop sequence bdo-mir-2c

AccessionMI0037250 (change log)
DescriptionBactrocera dorsalis miR-2c stem-loop
Literature search

1 open access papers mention bdo-mir-2c
(2 sentences)

Stem-loop
   ---        aag      ugua      -  gu 
5'    ucaucaaa   ggcugu    gauauu cu  a
      ||||||||   ||||||    |||||| ||  a
3'    aguaguuu   ccgaca    cuauga ga  c
   acg        cga      ----      a  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00020: 1019361-1019425 [+]
intergenic
Clustered miRNAs
< 10kb from bdo-mir-2c
bdo-mir-2cscaffold00020: 1019361-1019425 [+]
bdo-mir-13bscaffold00020: 1021893-1021956 [+]
Database links

Mature sequence bdo-miR-2c

Accession MIMAT0045373
Sequence

44 - 

ucacagccagcuuugaugagca

 - 65

Get sequence
Evidence experimental; Torrent [1]

References

1