Stem-loop sequence gmo-mir-17-2

AccessionMI0036215 (change log)
DescriptionGadus morhua miR-17-2 stem-loop
Literature search

1 open access papers mention gmo-mir-17-2
(4 sentences)

Stem-loop
   --c         a  g     g   ucuu 
5'    aaagugcuu ca ugcag uag    a
      ||||||||| || ||||| |||    c
3'    uuucacgga gu acguc auc    a
   gac         a  g     -   uaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GadMor_May2010; GCA_000231765.1) Overlapping transcripts
HE569758.1: 354880-354937 [+]
intergenic
Clustered miRNAs
< 10kb from gmo-mir-17-2
gmo-mir-17-2HE569758.1: 354880-354937 [+]
gmo-mir-18a-1HE569758.1: 355007-355068 [+]
gmo-mir-19a-2HE569758.1: 355142-355198 [+]
gmo-mir-20a-2HE569758.1: 355323-355382 [+]
gmo-mir-19b-1HE569758.1: 355452-355513 [+]
gmo-mir-92-1HE569758.1: 355560-355615 [+]
Database links

Mature sequence gmo-miR-17-5p

Accession MIMAT0044301
Sequence

1 - 

caaagugcuuacagugcaggua

 - 22

Get sequence
Evidence experimental; SOLiD [1], Illumina [2]

References

1
PMID:25881242 "Temperature during early development has long-term effects on microRNA expression in Atlantic cod" Bizuayehu TT, Johansen SD, Puvanendran V, Toften H, Babiak I BMC Genomics. 16:305(2015).
2