![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence sly-MIR408 |
|||||
Accession | MI0033679 (change log) | ||||
Description | Solanum lycopersicum miR408 stem-loop | ||||
Literature search |
![]()
9 open access papers mention sly-MIR408 | ||||
Stem-loop |
-- u a c c a ag u uuu 5' ga ag cgggga gag cag gcaug aug gcaa u || || |||||| ||| ||| ||||| ||| |||| 3' cu uc gucccu cuc guc cguac uau cguu u uc c g u c a cu c ucg |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence sly-miR408 |
|
Accession | MIMAT0042005 |
Sequence |
6 - acggggacgagccagagcaug - 26 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:25218481
"Prediction and characterization of Tomato leaf curl New Delhi virus (ToLCNDV) responsive novel microRNAs in Solanum lycopersicum"
Virus Res. 195:183-195(2015).
|