Stem-loop sequence sly-MIR172c

Accession

MI0033678 (change log)

Description

Solanum lycopersicum miR172c stem-loop

Literature search

28 open access papers mention sly-MIR172c
(123 sentences)

Stem-loop

   --ca a         u         a     auuuau    aau        cc    u     u      -      u 
5'     g ugcagcauc ucaagauuc cauag      auaa   auagaguu  augu ugggg gaaagu aauuaa u
       | ||||||||| ||||||||| |||||      ||||   ||||||||  |||| ||||| |||||| ||||||  
3'     c acgucguag aguucuaag guguu      uauu   uaucucgg  uaua auccu cuuuua uuaauu a
   acgg g         u         a     guuuau    agu        -u    u     -      a      a 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (SL2.50; GCA_000188115.2): chr4: 4093786-4093940 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0033678

Mature sequence sly-miR172c

• Accession: MIMAT0042004
• Sequence: 130 - agaaucuugaugaugcugcag - 150
• Evidence: experimental; Illumina [1]

References

1. PMID:25218481 "Prediction and characterization of Tomato leaf curl New Delhi virus (ToLCNDV) responsive novel microRNAs in Solanum lycopersicum" Pradhan B, Naqvi AR, Saraf S, Mukherjee SK, Dey N Virus Res. 195:183-195(2015).