Stem-loop sequence ssc-mir-375

Accession

MI0033409 (change log)

Description

Sus scrofa miR-375 stem-loop

Literature search

6 open access papers mention ssc-mir-375
(8 sentences)

Stem-loop

       c   c    a      ccu  c     c  gac 
5' cccc gcc cgcg cgagcc   cg acaaa cg   c
   |||| ||| |||| ||||||   || ||||| ||    
3' gggg cgg gugc gcucgg   gc uguuu gc   u
       a   a    -      cuu  u     u  gag 

Deep sequencing

239 reads, 9.09 reads per million, 11 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Sscrofa10.2; GCA_000003025.4): chr15: 133957549-133957623 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0033409

Mature sequence ssc-miR-375

• Accession: MIMAT0041608
• Sequence: 46 - uuuguucguucggcucgcguga - 67
• Deep sequencing: 239 reads, 11 experiments
• Evidence: experimental; Illumina [1]

References

1. PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).