Stem-loop sequence ssc-mir-223

Accession

MI0033408 (change log)

Description

Sus scrofa miR-223 stem-loop

Literature search

12 open access papers mention ssc-mir-223
(33 sentences)

Stem-loop

     a    cc u              gaguug       cau 
5' cc cgcu  g guauuugacaagcu      gacacuc   g
   || ||||  | ||||||||||||||      |||||||   u
3' gg guga  c cauaaacuguuuga      cugugag   a
     c    ac c              ------       aug 

Deep sequencing

212 reads, 0 reads per million, 14 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Sscrofa10.2; GCA_000003025.4): chrX: 58752425-58752503 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0033408

Mature sequence ssc-miR-223

• Accession: MIMAT0041607
• Sequence: 51 - ugucaguuugucaaauacccc - 71
• Deep sequencing: 208 reads, 14 experiments
• Evidence: experimental; Illumina [1]

References

1. PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).